ID 21-W479
Registered: 2010.07.02 Last update: 2010.08.27
| Gene Name | transcriptional regulating factor 1 | Gene Symbol | Trerf1 | |||
| Chromosome | 17 | Genomic Location | chr17:47,270,000-47,500,000 |  |
||
| Synonyms | RAPA, Trep132, AI429294, Trep-132, MGC118525, B830015H24, 9430096I18Rik | |||||
| Links |
UCSC Genome Browser(chr17:47,270,000-47,500,000) NCBI Gene(224829) IGTC(Trerf1,14289) UNIGene(Mm.260989) |
MGI(2442086) KEGG GENES(mmu:224829) EST Profile(mm.260989) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T155, 21-W393, 21-KBW258, K14A05 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB570400 | GSS Location | chr17:47,278,786-47,278,858 | Size | 73 |
| Sequence | CCATCTCACCCCCCCAAGTGGAGATTGGTCGTCTTGTCGGATTGCCCAGGCACTTGTTGCCGAAA CAGCCAAG |
||||
| Links |
UCSC Browser(chr17:47,278,786-47,278,858) IGTC(Ayu21-W479) |
||||
Homology Search Results
| [NM_001097623] Mus musculus transcriptional regulating factor 1 (Trerf1), transcript variant 1, mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Trerf1) |
||||