Gene Name | transcriptional regulating factor 1 | Gene Symbol | Trerf1 | |||
Chromosome | 17 | Genomic Location | chr17:47,270,000-47,500,000 | ![]() |
||
Synonyms | 9430096I18Rik, Trep132, Trep-132 | |||||
Links |
UCSC Genome Browser(chr17:47,270,000-47,500,000) NCBI Gene(224829) IGTC(Trerf1,14289) UNIGene(Mm.260989) |
MGI(2442086) KEGG GENES(mmu:224829) EST Profile(mm.260989) |
Other Clone Trapped This Gene |
---|
21-T155, 21-W393, 21-W479, 21-KBW258 |
Trap Vector | pCMT-SAhygpA-NP22 | Cell Line | vdR2-4 | Method | Splinkerette PCR |
Accession | AG999706 | GSS Location | chr17:47,278,884-47,278,985 | Size | 102 |
Sequence | ATTTAAAAAAAAATAGTTGGGAGGAGGGATGCTCCGTAAGAAGATGGGGGTGGAGTGTGGAGGGA AGCCTGCGGGGGACACAGAAAGACAAGTCTCCCGAGG |
||||
Links |
UCSC Browser(chr17:47,278,884-47,278,985) IGTC(AyuK1A05) |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the gene trap vector pCMT-SAhygpA-NP22 and the ES cell line vdR2-4. Homozygous mutation was introduced at the vector insertion site by exploiting mitotic recombination induced with transient disruption of the Bloom’s syndrome gene. This double knock out ES cell line was established by Takeda Laboratory at Osaka University, and deposited to the EGTC. Please check Homozygous ES Cell Database. This sequence-tag is genomic sequence of 3'-flanking region obtained by Splinkerette PCR. [Paper] "A homozygous mutant embryonic stem cell bank applicable for phenotype-driven genetic screening." Horie, K., Kokubu, C., Toshida, J., Akagi, K., Isotani, A., Oshitani, A., Yusa, K., Ikeda, R., Huang, Y., Bradley, A. and Takeda, J., Nature Methods, 8, 1071-1077 (2011). PubMed ID:22020066. |
||||
Links |
IMSR (for Trerf1) |