ID 21-W393
Registered: 2009.11.17 Last update: 2010.01.08
| Gene Name | transcriptional regulating factor 1 | Gene Symbol | Trerf1 | |||
| Chromosome | 17 | Genomic Location | chr17:47,275,000-47,502,000 |  |
||
| Synonyms | RAPA, Trep132, AI429294, Trep-132, MGC118525, B830015H24; 9430096I18Rik | |||||
| Links |
UCSC Genome Browser(chr17:47,275,000-47,502,000) NCBI Gene(224829) IGTC(Trerf1,14289) UNIGene(Mm.260989) |
MGI(2442086) KEGG GENES(mmu:224829) EST Profile(mm.260989) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T155, 21-W479, 21-KBW258, K14A05 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB533333 | GSS Location | chr17:47,278,773-47,278,858 | Size | 87 |
| Sequence | ACTCGGCTCGCCCCCCATCTCACCCCCCCAAGTGGAGATTGGTCGTCTTGTCGGATTGCCCAGGC ACTTGTTGCCGAAACAGCCAAG |
||||
| Links |
UCSC Browser(chr17:47,278,773-47,278,858) IGTC(Ayu21-W393) |
||||
Homology Search Results
| [BC059215] Mus musculus transcriptional regulating factor 1, mRNA (cDNA clone MGC:66566 IMAGE:6412734), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Trerf1) |
||||