Gene Name | LTR | Gene Symbol | LTR | |||
Chromosome | Unlocalized | Genomic Location | ![]() |
|||
Synonyms | ||||||
Links |
UCSC Genome Browser() NCBI Gene() IGTC(LTR,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-W349, 21-KBW138, 21-T263, 21-T32, 21-T83, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB300722 | GSS Location | Size | 24 | |
Sequence | GTCGAATCCACTGTCTCCTGTTGT | ||||
Links |
UCSC Browser() IGTC() |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for LTR) |