ID 21-T32
Registered: 2006.07.02 Last update: 2018.06.08
| Gene Name | LTR | Gene Symbol | LTR | |||
| Chromosome | Unlocalized | Genomic Location |  |
|||
| Synonyms | ||||||
| Links |
UCSC Genome Browser() NCBI Gene() IGTC(LTR,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W349, 21-KBW138, 21-T263, 21-T165, 21-T83, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB264306 | GSS Location | Size | 98 | |
| Sequence | CGCTATTGTCCTGATCTCTGAATTGGGCCTCTCCCCCTGAGAAGAANAGGGGGTCAAAAGCGGGC CACCGACACATGGATTCCAAGAACTAGAACTAG |
||||
| Links |
UCSC Browser() IGTC(Ayu21-T32) |
||||
Homology Search Results
Mouse Information
| Card ID | 827 | ||||
| Strain Name | B6;CB-LTRGt(pU-21T)32Imeg | ||||
| Internal Code | Ayu21-T32 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for LTR) |
||||