Gene Name | LTR | Gene Symbol | LTR | |||
Chromosome | Unlocalized | Genomic Location | ![]() |
|||
Synonyms | ||||||
Links |
UCSC Genome Browser() NCBI Gene() IGTC(LTR,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-W349, 21-KBW138, 21-T263, 21-T165, 21-T83, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB264306 | GSS Location | Size | 98 | |
Sequence | CGCTATTGTCCTGATCTCTGAATTGGGCCTCTCCCCCTGAGAAGAANAGGGGGTCAAAAGCGGGC CACCGACACATGGATTCCAAGAACTAGAACTAG |
||||
Links |
UCSC Browser() IGTC(Ayu21-T32) |
Card ID | 827 | ||||
Strain Name | B6;CB-LTRGt(pU-21T)32Imeg | ||||
Internal Code | Ayu21-T32 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for LTR) |