ID 21-T83
Registered: 2006.11.23 Last update: 2018.06.14
| Gene Name | LTR | Gene Symbol | LTR | |||
| Chromosome | Unlocalized | Genomic Location |  |
|||
| Synonyms | ||||||
| Links |
UCSC Genome Browser() NCBI Gene() IGTC(LTR,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W349, 21-KBW138, 21-T263, 21-T32, 21-T165, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB284378 | GSS Location | Size | 120 | |
| Sequence | GCAGTCTTCCACTATCAGCCTTTGGATGAAGACATAGAACTCTCAGCTCCTCCTGTGCCATGCCT GCCTGGATACTGACATGCTCCCACTTTGATGATAATGGACTGAACCACTGAACCT |
||||
| Links |
UCSC Browser() IGTC(Ayu21-T83) |
||||
Homology Search Results
| [BY032098] BY032098 RIKEN full-length enriched, blastocyst Mus musculus cDNA clone I1C0010E05 5', mRNA sequence. |
| [BC019681] Mus musculus RIKEN cDNA 9930105H17 gene, mRNA (cDNA clone IMAGE:3491837), partial cds. |
Mouse Information
| Card ID | 1039 | ||||
| Strain Name | B6;CB-LTRGt(pU-21T)83Imeg | ||||
| Internal Code | Ayu21-T83 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for LTR) |
||||