ID 21-KBW138
Registered: 2008.11.11 Last update: 2018.05.26
| Gene Name | LTR | Gene Symbol | LTR | |||
| Chromosome | Unlocalized | Genomic Location |  |
|||
| Synonyms | ||||||
| Links |
UCSC Genome Browser() NCBI Gene() IGTC(LTR,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W349, 21-T263, 21-T32, 21-T165, 21-T83, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132 |
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB469861 | GSS Location | Size | 69 | |
| Sequence | GGTCGAAACCACTGTCTCCTGCGTGAGATACGTTTCGAACCGGAGCTCCGCCATTATGGCTCCAC CATG |
||||
| Links |
UCSC Browser() IGTC(Ayu21-KBW138) |
||||
Homology Search Results
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for LTR) |
||||