Gene Name | LTR | Gene Symbol | LTR | |||
Chromosome | Unlocalized | Genomic Location | ![]() |
|||
Synonyms | ||||||
Links |
UCSC Genome Browser() NCBI Gene() IGTC(LTR,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-W349, 21-T263, 21-T32, 21-T165, 21-T83, 21-MT92, 21-MT109, 21-MT117, 21-MT120, 21-MT132 |
Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
Accession | AB469861 | GSS Location | Size | 69 | |
Sequence | GGTCGAAACCACTGTCTCCTGCGTGAGATACGTTTCGAACCGGAGCTCCGCCATTATGGCTCCAC CATG |
||||
Links |
UCSC Browser() IGTC(Ayu21-KBW138) |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for LTR) |