| Gene Name | New | Gene Symbol | New | |||
| Chromosome | 16 | Genomic Location | chr16:3,847,143-3,847,232 | |||
| Synonyms | ||||||
| Links | 
      UCSC Genome Browser(chr16:3,847,143-3,847,232) NCBI Gene() IGTC(New,) UNIGene(Mm.)  | 
    
    MGI()  KEGG GENES(mmu:) EST Profile(mm.)  | 
  ||||
| Other Clone Trapped This Gene | 
|---|
| 21-T536, 21-105, 21-103, 21-107, 21-MT62, 21-138, 21-106, 21-B137, 21-T237, 21-MT12, 21-B112, 21-56, 21-T112, 21-T227, 21-T233, 21-T317, 21-MT89, 21-T326, 21-T230, 21-T274, 21-T240, 21-W84, 21-T268, 21-T307, 21-T472, 21-T485, 21-T491, 21-T492, 21-T497, 21-T499, 21-MT74, 21-MT141, 21-KBW109, 21-W36, 21-MT1, 21-MT13, 21-W159, 21-W114, 21-W150, 21-T501, 21-W79, 21-W115, 21-W135, 21-W23, 21-W110, 21-W52, 21-W132, 21-W19, 21-W203, 21-W250, 21-W288, 21-W241, 21-W348, 21-B208, 21-W542, 21-T303, 21-W563, 21-W317, 21-MT16, 21-W445, 21-KBW175, 21-MT66, 21-T65, 21-KBW253, 21-T225, 21-58, 21-W10, 21-T7, 21-MT46, 21-MT30, 21-B200, 21-T334, 21-T431, 21-KBW53, 21-KBW254, 21-T285, 21-T540, 21-11, 21-W475 | 
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE | 
| Accession | AB292616 | GSS Location | chr16:3,847,175-3,847,201 | Size | 37 | 
| Sequence | CGGGAAGGCCCGCCTCTCCTCTACAGGCGAGAACTAG | ||||
| Links | 
    UCSC Browser(chr16:3,847,175-3,847,201) IGTC(Ayu21-T182)  | 
  ||||
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links | 
      IMSR (for New) | 
  ||||