ID 21-W288
Registered: 2009.07.01 Last update: 2015.08.19
| Gene Name | New | Gene Symbol | New | |||
| Chromosome | 6 | Genomic Location | chr6:49,162,459-49,173,858 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr6:49,162,459-49,173,858) NCBI Gene() IGTC(New,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T536, 21-105, 21-103, 21-107, 21-MT62, 21-138, 21-106, 21-B137, 21-T237, 21-MT12, 21-B112, 21-56, 21-T182, 21-T112, 21-T227, 21-T233, 21-T317, 21-MT89, 21-T326, 21-T230, 21-T274, 21-T240, 21-W84, 21-T268, 21-T307, 21-T472, 21-T485, 21-T491, 21-T492, 21-T497, 21-T499, 21-MT74, 21-MT141, 21-KBW109, 21-W36, 21-MT1, 21-MT13, 21-W159, 21-W114, 21-W150, 21-T501, 21-W79, 21-W115, 21-W135, 21-W23, 21-W110, 21-W52, 21-W132, 21-W19, 21-W203, 21-W250, 21-W241, 21-W348, 21-B208, 21-W542, 21-T303, 21-W563, 21-W317, 21-MT16, 21-W445, 21-KBW175, 21-MT66, 21-T65, 21-KBW253, 21-T225, 21-58, 21-W10, 21-T7, 21-MT46, 21-MT30, 21-B200, 21-T334, 21-T431, 21-KBW53, 21-KBW254, 21-T285, 21-T540, 21-11, 21-W475 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB510938 | GSS Location | chr6:49,168,140-49,168,177 | Size | 36 |
| Sequence | AATGGGTGGAGACCAGCTAAGACCAGAGGCGGCAAC | ||||
| Links |
UCSC Browser(chr6:49,168,140-49,168,177) IGTC(Ayu21-W288) |
||||
Homology Search Results
Mouse Information
| Card ID | 1867 | ||||
| Strain Name | B6;CB-<i>Gt(pU-21W)288Card</i> | ||||
| Internal Code | Ayu21-W288 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for New) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |