ID 21-W10
Registered: 2008.04.24 Last update: 2012.09.01
| Gene Name | New | Gene Symbol | New | |||
| Chromosome | 1 | Genomic Location | chr1:93,437,000-93,450,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr1:93,437,000-93,450,000) NCBI Gene() IGTC(New,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T536, 21-105, 21-103, 21-107, 21-MT62, 21-138, 21-106, 21-B137, 21-T237, 21-MT12, 21-B112, 21-56, 21-T182, 21-T112, 21-T227, 21-T233, 21-T317, 21-MT89, 21-T326, 21-T230, 21-T274, 21-T240, 21-W84, 21-T268, 21-T307, 21-T472, 21-T485, 21-T491, 21-T492, 21-T497, 21-T499, 21-MT74, 21-MT141, 21-KBW109, 21-W36, 21-MT1, 21-MT13, 21-W159, 21-W114, 21-W150, 21-T501, 21-W79, 21-W115, 21-W135, 21-W23, 21-W110, 21-W52, 21-W132, 21-W19, 21-W203, 21-W250, 21-W288, 21-W241, 21-W348, 21-B208, 21-W542, 21-T303, 21-W563, 21-W317, 21-MT16, 21-W445, 21-KBW175, 21-MT66, 21-T65, 21-KBW253, 21-T225, 21-58, 21-T7, 21-MT46, 21-MT30, 21-B200, 21-T334, 21-T431, 21-KBW53, 21-KBW254, 21-T285, 21-T540, 21-11, 21-W475 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435085 | GSS Location | chr1:93,437,164-93,437,208 | Size | 59 |
| Sequence | GGCTGGGGTCTCCACTTACCGGCCTGGCTAACGNACTTGATTGCTGAGAGGAACCGAAA | ||||
| Links |
UCSC Browser(chr1:93,437,164-93,437,208) IGTC(Ayu21-W10) |
||||
Homology Search Results
| [AK153774] Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630082J01 product:ankyrin repeat and SOCS box-containing protein 1, full insert sequence. |
Mouse Information
| Card ID | 1186 | ||||
| Strain Name | B6;CB-Asb1Gt(pU-21W)10Card | ||||
| Internal Code | Ayu21-W10 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This clone trapped the anti-sense transcript of Asb1 gene. | ||||
| Links |
IMSR (for New) |
||||