Gene Name | New | Gene Symbol | New | |||
Chromosome | 7 | Genomic Location | chr7:26,050,187-26,054,956 | |||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr7:26,050,187-26,054,956) NCBI Gene() IGTC(New,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
Other Clone Trapped This Gene |
---|
21-T536, 21-105, 21-103, 21-107, 21-MT62, 21-138, 21-106, 21-B137, 21-T237, 21-MT12, 21-B112, 21-56, 21-T182, 21-T112, 21-T227, 21-T233, 21-T317, 21-MT89, 21-T326, 21-T230, 21-T274, 21-T240, 21-W84, 21-T268, 21-T307, 21-T472, 21-T485, 21-T491, 21-T492, 21-T497, 21-T499, 21-MT74, 21-MT141, 21-KBW109, 21-W36, 21-MT1, 21-MT13, 21-W159, 21-W150, 21-T501, 21-W79, 21-W115, 21-W135, 21-W23, 21-W110, 21-W52, 21-W132, 21-W19, 21-W203, 21-W250, 21-W288, 21-W241, 21-W348, 21-B208, 21-W542, 21-T303, 21-W563, 21-W317, 21-MT16, 21-W445, 21-KBW175, 21-MT66, 21-T65, 21-KBW253, 21-T225, 21-58, 21-W10, 21-T7, 21-MT46, 21-MT30, 21-B200, 21-T334, 21-T431, 21-KBW53, 21-KBW254, 21-T285, 21-T540, 21-11, 21-W475 |
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB467275 | GSS Location | chr7:26,052,546-26,052,598 | Size | 49 |
Sequence | GTTGGTGCTGGTAAACCCAGAGTAGAGAAGTTTGGGGTAGGAAGAGGAG | ||||
Links |
UCSC Browser(chr7:26,052,546-26,052,598) IGTC(Ayu21-W114) |
Card ID | 2770 | ||||
Strain Name | B6;CB-Gt(pU-21W)114Card | ||||
Internal Code | Ayu21-W114 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for New) |