ID 21-T501

Registered: 2008.11.05   Last update: 2008.11.05
Gene Name New Gene Symbol New
Chromosome 6 Genomic Location chr6:37,699,127-37,699,216
Synonyms
Links UCSC Genome Browser(chr6:37,699,127-37,699,216)
NCBI Gene()
IGTC(New,)
UNIGene(Mm.)
MGI()
KEGG GENES(mmu:)
EST Profile(mm.)
Other Clone Trapped This Gene
21-T536, 21-105, 21-103, 21-107, 21-MT62, 21-138, 21-106, 21-B137, 21-T237, 21-MT12, 21-B112, 21-56, 21-T182, 21-T112, 21-T227, 21-T233, 21-T317, 21-MT89, 21-T326, 21-T230, 21-T274, 21-T240, 21-W84, 21-T268, 21-T307, 21-T472, 21-T485, 21-T491, 21-T492, 21-T497, 21-T499, 21-MT74, 21-MT141, 21-KBW109, 21-W36, 21-MT1, 21-MT13, 21-W159, 21-W114, 21-W150, 21-W79, 21-W115, 21-W135, 21-W23, 21-W110, 21-W52, 21-W132, 21-W19, 21-W203, 21-W250, 21-W288, 21-W241, 21-W348, 21-B208, 21-W542, 21-T303, 21-W563, 21-W317, 21-MT16, 21-W445, 21-KBW175, 21-MT66, 21-T65, 21-KBW253, 21-T225, 21-58, 21-W10, 21-T7, 21-MT46, 21-MT30, 21-B200, 21-T334, 21-T431, 21-KBW53, 21-KBW254, 21-T285, 21-T540, 21-11, 21-W475
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB469151 GSS Location chr6:37,699,157-37,699,186 Size 30
Sequence ATTTCAAAGCACACTGGAATCCTGAGGCAG
Links UCSC Browser(chr6:37,699,157-37,699,186)
IGTC(Ayu21-T501)

Homology Search Results

Mouse Information

Card ID
Strain Name
Internal Code
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production.
Links IMSR (for New)