ID 21-T34

Registered: 2006.07.10   Last update: 2017.02.05
Gene Name EST Gene Symbol EST
Chromosome 2 Genomic Location chr2:168,825,745-168,837,444
Synonyms
Links UCSC Genome Browser(chr2:168,825,745-168,837,444)
NCBI Gene()
IGTC(EST,)
UNIGene(Mm.)
 MGI()
KEGG GENES(mmu:)
EST Profile(mm.)
Other Clone Trapped This Gene
21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB265217 GSS Location chr2:168,831,537-168,831,653 Size 117
Sequence ATCAGGTTGGAAGAGTGTGGAGTGACGCCATGCTTGAGAAGAGAGCAGGACAAAAGAGCACGGCC
CTGAGGGTTGCCCAACAGGGTCTAGAGCGGCCAAGATAGAACATAGAATTCA
Links UCSC Browser(chr2:168,831,537-168,831,653)
IGTC(Ayu21-T34)

Homology Search Results

[DU821628] D046D06 GV09C04 Mus musculus cDNA clone D046D06, mRNA sequence.
[CF166997] B0778F08-5 NIA Mouse Embryonic Germ Cell cDNA Library (Long) Mus musculus cDNA clone NIA:B0778F08 IMAGE:30465379 5', mRNA sequence.

Mouse Information

Card ID 1063
Strain Name B6,Cg-Gt(pU-21T)34Imeg
Internal Code Ayu21-T34
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for EST)