ID 21-B161
Registered: 2006.03.06 Last update: 2015.08.11
| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 7 | Genomic Location | chr7:116,843,735-116,850,434 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr7:116,843,735-116,850,434) NCBI Gene() IGTC(EST,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB252560 | GSS Location | chr7:116,847,052-116,847,118 | Size | 67 |
| Sequence | AGCCTTAATCAGCTTCAGACGCGAAGCGGGCGCTTGTTGTCGTTCGAGGACTTTCTTGCCGCGAC AG |
||||
| Links |
UCSC Browser(chr7:116,847,052-116,847,118) IGTC(Ayu21-B161) |
||||
Homology Search Results
| [BB870071] RIKEN full-length enriched, 11 days embryo spinal cord Mus musculus cDNA clone G630018B13 5', mRNA sequence. |
Mouse Information
| Card ID | 648 | ||||
| Strain Name | B6;CB-Gt(pU-21B)161Imeg | ||||
| Internal Code | Ayu21-B161 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for EST) |
||||