ID 21-W492
Registered: 2010.07.15 Last update: 2020.06.02
| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 3 | Genomic Location | chr3:19,822,238-19,845,997 |  |
||
| Synonyms | Ayu21-KBW53 | |||||
| Links |
UCSC Genome Browser(chr3:19,822,238-19,845,997) NCBI Gene() IGTC(EST,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB571316 | GSS Location | chr3:19,834,065-19,834,161 | Size | 97 |
| Sequence | CCAGGTCTCCATATGCTCAGTCAAATCTCCATAACTGTAAATCAACACTAAGAGCACTGGATAGT TAAAGTCAAGGAGACTCTCACAAAGGATCCAG |
||||
| Links |
UCSC Browser(chr3:19,834,065-19,834,161) IGTC(Ayu21-W492) |
||||
Homology Search Results
| [CF896815] A0215H10-5 NIA Mouse Embryonic Germ Cell cDNA Library (Long, subtracted) Mus musculus cDNA clone NIA:A0215H10 IMAGE:30729885 5', mRNA sequence. |
Mouse Information
| Card ID | 2869 | ||||
| Strain Name | B6;CB-Gt(pU-21W)492Card | ||||
| Internal Code | Ayu21-W492 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for EST) |
||||