ID 21-B169
Registered: 2006.05.19 Last update: 2015.08.11
| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 9 | Genomic Location | chr9:114,487,386-114,489,118 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr9:114,487,386-114,489,118) NCBI Gene() IGTC(EST,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB259817 | GSS Location | chr9:114,488,226-114,488,277 | Size | 52 |
| Sequence | CCCTGCAAAGAGTCCGTGCCCTGAGTCTGGAAGCACAGAGCTGCTGACAGAG | ||||
| Links |
UCSC Browser(chr9:114,488,226-114,488,277) IGTC(Ayu21-B169) |
||||
Homology Search Results
| [CG609369] OST290531 Mus musculus 129Sv/Ev Mus musculus cDNA clone OST290531, mRNA sequence. |
Mouse Information
| Card ID | 720 | ||||
| Strain Name | B6;CB-Gt(pU-21B)169Imeg | ||||
| Internal Code | Ayu21-B169 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for EST) |
||||