| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 6 | Genomic Location | chr6:148,770,000-148,790,000 | |||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr6:148,770,000-148,790,000) NCBI Gene() IGTC(EST,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB491939 | GSS Location | chr6:148,780,072-148,780,230 | Size | 158 |
| Sequence | CAGAGACGCCATGATGCTCGTCTCAGGAGCCGGCATTCATTGCACAGCGGTGCTGCTACAGGAAG TCGCTCAAGTTTGTTCCAAACACCAGACTCCCGCAGACGGCCGCCATGATGCGGTACGGAAATCC TAGCTTGTCCACCCACTGGTGTACCAAA |
||||
| Links |
UCSC Browser(chr6:148,780,072-148,780,230) IGTC(Ayu21-W248) |
||||
| [AK160206] Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610017A05 product:unclassifiable, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for EST) |
||||