ID 21-T412
Registered: 2007.09.28 Last update: 2015.08.17
| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 12 | Genomic Location | chr12:21,423,012-21,424,211 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr12:21,423,012-21,424,211) NCBI Gene(22630) IGTC(EST,) UNIGene(Mm.) |
MGI(891963) KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB362537 | GSS Location | chr12:21,423,592-21,423,631 | Size | 40 |
| Sequence | CCGAGGGTGGGTCGGCTCGGGTAGGTTCGGTTGGCCCGCA | ||||
| Links |
UCSC Browser(chr12:21,423,592-21,423,631) IGTC(Ayu21-T412) |
||||
Homology Search Results
| [BU936622] AGENCOURT_10523874 NIH_MGC_169 Mus musculus cDNA clone IMAGE:6704405 5-, mRNA sequence, gi|24125441|gb|BU936622.1|[24125441] |
Mouse Information
| Card ID | 1087 | ||||
| Strain Name | B6,Cg-Gt(pU-21T)412Imeg | ||||
| Internal Code | Ayu21-T412 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for EST) |
||||