| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 1 | Genomic Location | chr1:174,301,000-174,312,000 | |||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr1:174,301,000-174,312,000) NCBI Gene() IGTC(EST,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W548, 21-B145, 21-129, 21-KBW264, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB573685 | GSS Location | chr1:174,306,579-174,306,627 | Size | 50 |
| Sequence | GGGGCTCTCAGCTGTCTCCGCCGAACGATTGCCTTCCTCGGGATTGGCTG | ||||
| Links |
UCSC Browser(chr1:174,306,579-174,306,627) IGTC(Ayu21-W557) |
||||
| [AK017103] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4933437L05 product:phosphatidylinositol glycan, class M, full insert sequence. |
| Card ID | 1786 | ||||
| Strain Name | B6;CB-<i>Gt(pU-21W)557Card</i> | ||||
| Internal Code | Ayu21-W557 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for EST) |
||||
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |