ID 21-KBW264
Registered: 2011.08.21 Last update: 2015.08.19
| Gene Name | EST | Gene Symbol | EST | |||
| Chromosome | 14 | Genomic Location | chr14:76,915,549-76,931,242 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr14:76,915,549-76,931,242) NCBI Gene() IGTC(EST,) UNIGene(Mm.455633) |
MGI() KEGG GENES(mmu:) EST Profile(mm.455633) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B169, 21-8, 21-115, 21-140, 18-91, 21-B165, 21-B161, 21-T34, 21-T82, 21-T188, 21-T261, 21-T413, 21-T412, 21-T526, 21-KBW91, 21-KBW97, 21-MT63, 21-W248, 21-W492, 21-W207, 21-KBW219, 21-W415, 21-W360, 21-W535, 21-W557, 21-W548, 21-B145, 21-129, 21-MT3, 21-B129, 21-T104, 21-W586, 21-W30, 21-W206, 21-B198 |
| Trap Vector | pU-21W | Cell Line | KAB6 (Albino B6) | Method | 5'-RACE |
| Accession | AB665542 | GSS Location | chr14:76,915,751-76,915,904 | Size | 154 |
| Sequence | GGTCATTGAAGTTTCAAAAGCTAGACCCTGGCCAGGGTCTTTCTCTTCCTGCCGCGCTCCCTCAG AACTGGCTGAAGAACACTAGCTACTTCTCCAGCTGCGTGCCGCCATGTTCCCTGTCATGGGGATA AAGGGACTAAATCCCTCTGAAACG |
||||
| Links |
UCSC Browser(chr14:76,915,751-76,915,904) IGTC(Ayu21-KBW264) |
||||
Homology Search Results
| [AV508265] AV508265 Abe mouse ES cell Mus musculus cDNA clone 20000120EK03D01, mRNA sequence. |
Mouse Information
| Card ID | 1869 | ||||
| Strain Name | B6-Gt(pU-21KBW)264Card | ||||
| Internal Code | Au21-KBW264 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for EST) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |